Mutagenesis of EPHX2 Protein Cysteine Residues

The EPHX2 (T230-M555—hsEH CTD) cDNA was cloned in the bacterial expression vector pET3a, as described previously^{41 (link)}. Single mutants C423S and C522S were generated with the Q5^® Site-Directed Mutagenesis Kit (NEB). The double mutant C423S/C522S (C423S/C522S) was produced through two subsequent cycles of mutagenesis using the same kit. The mutagenic primers (Sigma), were designed with the NEB changer webtool according to the kit specifications (C423S_R: 5′GCATAAAGTCAGTGAAGCGGG3′; C423S_F: 5′ATGGATAAAACACTCTCATCG3′; C522S_R: 5′CATTGAGGACAGTGGGCACTG3′; C522S_F: 5′TGTCCCCTTTTCAGGTGG3′). Successful mutagenesis was confirmed by sequencing (Eurofins MWG).