The qRT-PCR was performed as published previously with minor modifications.23 (link) For RNA isolation, ~50 mg of At seedlings after were harvested with liquid nitrogen in the same light condition. Total RNA was isolated using Qiagen Plant RNeasy mini kit followed by cDNA preparation from 1 μg of RNA of each sample using Bio-Rad iScriptTM Reverse Transcription Super-mix. The quantitative RT-PCR (qRT-PCR) was performed using the CFX384 TouchTM Real-time detection system (Bio-Rad Laboratories), following the manual of iTaqTM universal SYBR green supermix. Gene-specific primers were designed using the Primer Quest tool. All reactions were carried out in Hard-shell 384-well PCR plates (provided by Bio-Rad, Cat #: HSP3805) Table 1. The PCR mix and thermocycler program for the qPCR were similar to those done by Singh, 2022.23 (link) Transcripts level were normalized with ACTIN. Each qRT-PCR reaction was performed in three biological replicates and all data were presented as mean ± SEM.

List of primers used in qRT-PCR.

GENESForward PrimerReverse Primer
TIR1TAATTTGGTACCTGACGGATGGCACCATCCTCTTCAGCCTTATC
IAA14CCTTCTAAGCCTCCTGCTAAAGCTTCGCCGCTCTTCTGATTA
ARF7CCCTCCAAGTTACTGAGCTTTCGCTGAGGCAACTGAGACATT
LBD16TCAAACCGGAGGAGGAGTATAGCCTGAAGCTCACCTAAATC
NAC1GGATCTCATCATCCTCCCAATCCAGCTTCCCATGTTGTCTCT
AIR3GGATGACATTCCTGGACCTATCGACCGGGATTCACAGCTAAA
ACTINCGATGAAGCTCAATCCAAACGACAGAGTCGAGCACAATACCG
Free full text: Click here