We amplified the synthesized oligo library using the following primer pair GGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse) with NEBNext High-Fidelity Master Mix (NEB, #M0531) for 10 cycles. The pooled library cloning process was performed according to our previous publication (25 (link)). Briefly, the amplified oligo library was purified and ligated into BsmBI-digested LentiGuide-Blast using Gibson assembly. Eight transformation reactions were conducted with 2 μl of ligation product into each tube of electrocompetent cells (Lucigen, #60242) and plated onto eight 15-cm plates with Carbenicillin selection (50 μg/ml). After 14 h, all the colonies were collected as a pool for plasmid library extraction with Endotoxin-Free Plasmid Maxiprep (Qiagen, #12362).