Cloning and Expression of Giardia Giardin Proteins

RNA was extracted from 1 × 10⁷ trophozoites in 1 ml of TRIzol reagent (Vazyme, Nanjing, China), genomic DNA was extracted from G. duodenalis total RNA using MonScript dsDNase (Monad, Wuhan, China) and complementary DNA (cDNA) was synthesized using the MonScript RTIII Super Mix (Monad) according to the manufacturer’s instructions.
The CDS sequence information of the target genes of G. duodenalis was obtained from the NCBI GenBank. Specific seamless cloning primers were designed separately for each target gene using Primer 5.0. The forward primers (5ʹ− 3ʹ) were composed of three parts, namely the overlap sequences with EcoRV-linearized pcDNA3.1(+) vector (TGGTGGAATTCTGCAGAT) and the initiation codon ATG and GNN (if the first base of the target gene was not G). This was done to enhance the expression efficiency. Additionally, no fewer than 16-bp combinative bases (40–60% GC contents/Tm value around 55 °C) were included. The reverse primers (5ʹ− 3ʹ) were composed of two parts, namely the overlap sequences with EcoRV-linearized pcDNA3.1(+) vector (GCCGCCACTGTGCTGGAT) and no fewer than 16-bp combinative bases (excluding the last two bases of the stop codon, such as AA or GA to make the recombinant plasmids express their tag protein). The primer sequences are listed in Table 1 and were synthesized by Comate Bioscience Company Limited (Changchun, China).Table 1

Primer sequences of recombinant pcDNA3.1(+)-alpha-2 and alpha-7.3 giardins

Primer name	Genbank number	Sequence (5ʹ-3ʹ)	Product size (bp)
Alpha-2 giardin	XM_001706906	F:TGGTGGAATTCTGCAGATATGGTTCCGAAGCTATCCCAGA	892
		R:GCCGCCACTGTGCTGGATACTCCCTTAGGCGCCAGA
Alpha-7.3 giardin	XM_001708403	F:TGGTGGAATTCTGCAGATATGGCTGCAGCGAAGGCTA	886
		R:GCCGCCACTGTGCTGGATACATGACGTGCCAGAGGAC

The underlined parts were introduced bases to enhance the expression efficiency of recombinant pcDNA3.1(+)-alpha-2 and alpha-7.3 giardins

F Forward primer, R reverse primer

The targets were amplified using Pfu (Tiangen, Beijing, China) or Ex-taq (Takara Biomedical Technology [Beijing] Co., Ltd., Beijing, China) DNA Polymerase, with the prepared G. duodenalis cDNA as the template. The eukaryotic expression vector plasmid pcDNA3.1(+) was linearized with the restriction enzyme EcoRV and dephosphorylated using Fast AP (Thermo Fisher Scientific). Both linearized pcDNA3.1(+) fragments and amplified target gene fragments were purified using a DNA Gel Purification Kit (Tiangen) and quantified using a Nanodrop ND-2000 (Thermo Fisher Scientific). The pcDNA3.1(+) fragments and each target gene fragment were recombined using the MonClone Single Assembly Cloning Mix (Monad Biotech Co., Ltd., Suzhou, China) and confirmed using DNA sequencing by Comate Bioscience Company Limited (Changchun, China).