Clonal Amplicon Sequencing of megaTAL Targets

Clonal amplicon sequencing was performed on DNA extracted from treated cells as previously described3 (link). Briefly, megaTAL target sites were amplified using Phusion polymerase (New England Biolabs), and primers HIVintF (TAGCAGGAAGATGGCCAGTA) and HIVintR (TCCTGTATGCAGACCCCAAT). PCR products were sub-cloned using the Zero Blunt TOPO PCR cloning kit (Life Technologies). TOPO-cloned PCR products were transformed into One Shot Top10 Escherichia coli (Life Technologies) for clonal analysis and individual colonies were picked for plasmid purification from which the clonal megaTAL target sites were sequenced using T7 or SP6 sequencing primers.