TALEN-Mediated Editing of ctnna1 Locus

TALENs targeting the ctnna1 locus were designed using the TALE-NT tool (https://tale-nt.cac.cornell.edu/node/add/talen) using the guidelines specified in Cermak et al. (2011) (link). The chosen optimal target sequence in exon 3: 5′- TTGTGTTTATTGCAGGTCACCACACTTGTGAACTCCAGCAACAAAGGTCCA-3′ (binding sites of the left and right TALEN arms are underlined) contains a HphI (NEB) restriction enzyme site (GGTGA). TALENs were generated using the Golden Gate kit (Cermak et al., 2011 (link)) in combination with the obligate heterodimeric FokI pCS2TAL3DD (Addgene, #37275) and pCS2TAL3RR (Addgene, #37276) backbones (Ota et al., 2013 (link)).
TALEN targeting plasmids were linearized with NotI (Promega) after which IVT mRNA was generated using the mMessage mMachine SP6 kit (Ambion), and purified using the RNeasy mini kit (Qiagen).

Free full text: Click here

Han M.K., Hoijman E., Nöel E., Garric L., Bakkers J, & de Rooij J. (2016). αE-catenin-dependent mechanotransduction is essential for proper convergent extension in zebrafish. Biology Open, 5(10), 1461-1472.

Publication 2016

pCS2TAL3DD pCS2TAL3RR mMessage mMachine SP6 kit RNeasy mini kit

Arms Backbones Binding sites Ctnna1 Exon Mrna Plasmids Promega Restriction enzyme Talen

Corresponding Organization :

Other organizations : University Medical Center Utrecht, Hubrecht Institute for Developmental Biology and Stem Cell Research

Top 5 similar protocols

Variable analysis

independent variables

TALENs targeting the ctnna1 locus

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive control: Not mentioned
Negative control: Not mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!