PI3Kβ Signaling Modulation Protocol

Antibodies used were anti-p110β, -p110α and -pPKB (Ser 473) (Cell Signaling), pan-p85 (Millipore), -E-cad, PCNA (BD Biosciences), -PKB (Upstate Biotechnology), -β-actin, -α-tubulin (Sigma), -N-cad (Abcam) and --catenin (BD). For in vivo assays, we used Stealth PIK3CB siRNA that targeted the sequences AACCACTGGAATTTGATATTAATAT (siRNA1) or GATTCACAGATAGCATCTGAT (siRNA2), or control (scrambled-siRNA1) and vehicle (Invivofectamine), (Invitrogen). We prepared doxycycline (doxy)-inducible-pLKO-tet-PIK3CB shRNA vector by subcloning in the EcoRI site the oligonucleotide CCGGGATTCACAGATAGCATC TGATCTCGAGATCAGATGCTATCTGTGAATCTTTTT and its reverse complementary oligonucleotide. We used RNAiMAX (Invitrogen) and OptiMem (Life Technologies) for siRNA transfection. pLKO-Puro-CDH1 shRNA and the dexamethasone (Dex)-inducible pLK-pac vector encoding CDH1 have been described [52 (link)]. The PI3Kβ inhibitor AZD8186 was from Astra Zeneca [20 (link)] . PSG5-ER-myc-K805R-p110β was prepared as described [25 (link)]. To generate a siPIK3CB resistant-K805R-p110β, we used the oligonucleotide GGAATGA ACCACTCGAATTTCATATTAATATTTGTGACTT ACCAAGAATGG and its reverse complementary in a PCR reaction using Quickchange (Agilent). ER-myc-KR-p110β was cotransfected with siRNA using Lipofectamine 2000 (Invitrogen); these cells were treated with tamoxifen (1 µM, Sigma) 12 h before analysis.