Quantifying CMV Promoter Binding Factors

RT-PCR was performed using the Roche LightCycler® 480 Real-Time PCR System and the LightCycler 480 Mastermix (04707494001 Roche, Indianapolis, IN). For quantification of CMV, the probe/primers combinations were as follows: forward primer: gcagagctcgtttagtgaacc; reverse primer: gaggtcaaaacagcgtggat; Universal ProbeLibrary probe: #80 (cat.no. 04689038001, Roche, Indianapolis, IN). Reaction conditions were set up according to the manufacturer’s instructions. Crossing points (Ct) were generated from the LightCycler Software. Relative quantification of the CMV promoter and GAPDH bound to the transcription factors was performed using the 2^delta delta Ct method [25 (link)]. All samples were normalized to the respective input DNA for the ChIP reaction (e.g. A0 cell line, CMV copies in input DNA) and then to sample 3 of the A0 CREB1 immunoprecipitated for CMV.