Constructing Lifeact-mEGFP Expression Constructs

pTH-Ubi-Lifeact-mEGFP was constructed via multi-site gateway (Invitrogen). Entry clones containing the Lifeact peptide and mEGFP were generated via BP clonase from PCR products. For Lifeact, the first 51 bp of the coding sequence of the ABP140 gene were amplified from yeast genomic DNA, using primers: LifeactB1F-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGGTGTCGCAGATTTG, and LifeactB5rR-GGGGACAACTTTTGTATACAAAGTTGTTTCTTCCTTTGAGATGCTTTC. For mEGFP, we used primers: attB2-mEGFP-STOP-r-GGGGACCACTTTGTACAAGAAAGCTGGGTATTACTTGTACAGCTCGTCCATGCC and attB5-mEGFP-STOP-f-GGGGACAACTTTGTATACAAAAGTTGTGGTGAGCAAGGGCGAGGAG. The entry clones generated by the BP clonase reaction were sequenced and cloned together into pTH-Ubi-Gate [2] (link) via LR clonase. The resulting expression construct was verified by restriction digest. For stable transformation, plasmids were digested with SwaI and transformed using standard procedures [13] (link). Stable plants were identified by the resistance to hygromycin, after periods of release from selection.
Lifeact-mEGFP was amplified out of pTH-Ubi-Lifeact-mEGFP using the sense primer GGGGGATCCATGGGTGTCGCAGATTTGAT and the anti-sense primer CACGTCGACTTACTTGTACAGCTCGTCC. For tobacco pollen expression, the fragment was then digested with Bam HI and Sal I and inserted into a modified pBS SKII+ that includes the Lat52 promoter [34] . For lily expression, the same construct was subcloned into pBS SKII+ under the control of the zmC13 promoter using the same enzymes [35] (link).