Reverse Transcription and qPCR for Gene Expression
RNA was extracted using TRIZol (Thermo Fisher), and reverse transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher), as previously described [39 (link)]. PCR was conducted on a Roche Lightcycler 480 machine using SensiFAST™ SYBR Lo-ROX Kit (Bioline). Primer sets used for PCR were human PFKFB3 F-CAGTTGTGGCCTCCAATATC, R-GGCTTCATAGCAACTGATCC [40 (link)]; human β-ACTIN F-CATGTACGTTGCTATCCAGGC, R- CTCCTTAATGTCACGCACGAT [41 (link)].
Liu X.T., Huang Y., Liu D., Jiang Y.C., Zhao M., Chung L.H., Han X.D., Zhao Y., Chen J., Coleman P., Ting K.K., Tran C., Su Y., Dennis C.V., Bhatnagar A., Liu K., Don A.S., Vadas M.A., Gorrell M.D., Zhang S., Murray M., Kavurma M.M., McCaughan G.W., Gamble J.R, & Qi Y. (2024). Targeting the SphK1/S1P/PFKFB3 axis suppresses hepatocellular carcinoma progression by disrupting glycolytic energy supply that drives tumor angiogenesis. Journal of Translational Medicine, 22, 43.
Other organizations :
University of Sydney, Centenary Institute, University of the Sunshine Coast, Dalian Minzu University, Royal Prince Alfred Hospital, Sydney Local Health District, The Heart Research Institute
Primer sets used for PCR (human PFKFB3 and human β-ACTIN)
dependent variables
Expression levels of PFKFB3 and β-ACTIN genes
control variables
Previously described experimental procedures [39]
controls
No explicit positive or negative controls are mentioned.
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
