Cloning and Sequencing of S. Typhimurium SspH2

S. Typhimurium sspH2 was PCR amplified from genomic SL1344 DNA using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGCCCTTTCATATTGGAAGC and GGGGACCACTTTGTACAAGAAAGCTGGGTTCAGTTACGACGCCACTGAACG. The sspH2 amplicon was purified by means of a Nucleospin® Gel and PCR clean-up kit (Macherey-Nagel) according to the manufacturers' instruction and cloned into the Gateway® pDONR221 and pMET7-GAG-SP1 (22 (link)) using BP Clonase II Enzyme (Invitrogen) and LR Clonase II Plus Enzyme (Invitrogen), respectively. The pMD2.G (VSV-G envelope-expressing plasmid; Addgene, plasmid no. 12259) and pcDNA3-FLAG-VSV-G (Addgene, plasmid no. 80606) plasmids were retrieved from Addgene and the pSVsport vector was obtained from Life Technologies. The correctness of the sspH2 insert was confirmed by Sanger sequencing (Eurofins).

Free full text: Click here

De Meyer M., Fijalkowski I., Jonckheere V., De Sutter D., Eyckerman S, & Van Damme P. (2021). Capturing Salmonella SspH2 Host Targets in Virus-Like Particles. Frontiers in Medicine, 8, 725072.

Publication 2021

Nucleospin® Gel and PCR clean-up kit BP Clonase II Enzyme LR Clonase II Plus Enzyme pMD2.G (VSV-G envelope-expressing plasmid; Sanger sequencing

Enzyme Genomic Plasmids Primers Vector

Corresponding Organization : Ghent University

Other organizations : Vlaams Instituut voor Biotechnologie

Top 5 similar protocols

Variable analysis

independent variables

PCR amplification of sspH2 from genomic SL1344 DNA using specific primers

dependent variables

Expression of sspH2 in the pMET7-GAG-SP1 plasmid

control variables

Nucleospin® Gel and PCR clean-up kit used for purification of sspH2 amplicon
Use of Gateway® pDONR221 and pMET7-GAG-SP1 plasmids for cloning
Use of BP Clonase II Enzyme and LR Clonase II Plus Enzyme for cloning
Retrieval of pMD2.G (VSV-G envelope-expressing plasmid) and pcDNA3-FLAG-VSV-G plasmids from Addgene
Obtaining pSVsport vector from Life Technologies
Confirmation of sspH2 insert correctness by Sanger sequencing

positive controls

None specified

negative controls

None specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!