Enzymatic Characterization of Trypanosome IPMK Mutants

The T. brucei gene encoding IPMK was cloned into pET-29a (Novagen) and expressed and purified from E. coli DE3 pLysS Rosetta cells (Novagen) as previously reported (Cestari et al., 2016 (link)). Site-directed mutagenesis of IPMK was performed using the pET-29-IPMK construct and a Q5 site-directed mutagenesis kit (New England Biolabs) according to the manufacturer's instructions. The forward and reverse primers used in site-direct mutagenesis reactions were as follows: D142A: TTGTGTGCTTGCTATCAAACTTG and GGTTTATGAAATGTCGCG, K164W: GCGCATACATTGGAGGCAGCTTC and TCCACCTTGTCGGGTAAT, and D142A/K144A: GCTTGCTATCGCACTTGGATATGTG and ACACAAGGTTTATGAAATGTC. Protein activity was assayed in 30-µl reactions in 96-well plates in a buffer consisting of 20 mM HEPES, 150 mM NaCl, and 2 mM MgCl₂ (pH 7.5). The reactions also contained 300 nM rTbIPMK WT or a mutant version thereof, 5–200 mM Ins(1,4,5)P3 or Ins(1,2,4,5)P4 (Echelon Biosciences), and 200 µM of ATP. Reactions were incubated for 60 min at 37°C, after which IMPK activity was measured using the ADP luciferase assay (Promega; Cestari et al., 2016 (link)) and a Glomax plate reader (Promega). Kinetic analyses were calculated by nonlinear regression using GraphPad Prism for Windows 5.03 (GraphPad Software).