To evaluate the SsMRT4 expression levels during mycelia development, wild-type strains were cultured on cellophane over PDA, and hyphae were harvested at 1 and 2 days post inoculation (dpi) (hyphae), 3 and 4 dpi (initial sclerotia), 5~7 dpi (developing sclerotia), and 15 dpi (mature sclerotia). Primers of SsMRT4 and β-tub-ulin used for qPCR were: SsMRT4qF (CCTCCATCATCACCTACTTCC)/SsMRT4 qR: (GGTTCCAAACTAT GTGCCATT) and SsTubqF (ACCTCCATCCAAGAACTC)/SsTubqR (GAACTCCAT CTCGTCCAT). β-tubulin was used as an internal reference. The program setting included holding stage (95 °C, 2 min), cycling stage (95 °C, 20 s; 55 °C, 20 s; 72 °C, 20 s; 40 cycles), and melt curve stage (95 °C, 15 s; 60 °C, 1 min). Quantitative expression assays were performed using SYBR® Green Premix Pro Taq HS qPCR Kit II (Accurate Biology) with StepOneTM Real-time PCR Instrument Thermal Cycling Block. The transcript level of the gene of interest was calculated from the threshold cycle using the 2-ΔΔCT method [37 (link)] with three replicates, and data were analyzed using SPSS Statistics v.24.0.
Free full text: Click here