The FISH procedure followed that described in Lee et al. [70 (link)]. The SatA probe was designed from a conserved region of the SatA monomer alignment and labeled with digoxigenin using oligonucleotide-5′-end-labeling (AAATCTGACCTAATTTGGACCCAATCTTTGAACCTTCTAATTGAAGGTCAATTGGTGT). Probes for 45S rDNA (pTA71 containing a repetitive unit of 45S rDNA from Triticum aestivum) [71 (link)] and 5S rDNA (pTA794 containing the 5S rDNA repeat unit from T. aestivum) [72 (link)] were also used. The rDNA sequences were labeled by nick translation with digoxigenin-11-dUTP orbiotin-16-dUTP (Roche Diagnostics GmbH, Penzberg, Germany). Digoxigenin-labeled probes were detected by anti-digoxigenin-rhodamine (Roche Diagnostics GmbH), whereas biotin-labeled probes were detected using fluorescein isothiocyanate (FITC)-conjugated avidin (Vector Laboratories, Burlingame, CA, USA). Chromosomes were counterstained with 4′, 6-diamidino-2-phenylindole (DAPI) in an anti-fade solution (Vector Laboratories, CA, USA). All images were captured digitally using a CCD camera attached to an epifluorescence microscope (Axioskop 2, Carl Zeiss AG, Germany). The CCD camera was controlled by Image-Pro Plus software (version 4.5.1, Media Cybernetics, Yorktown, VA, USA), and final image adjustments were made with Adobe Photoshop CS2 (version 9.0.2, Adobe Systems Inc., San Jose, CA, USA).
Free full text: Click here
