Methylation Analysis of CpG Island Promoters

The analysis is based on previously described method[35 (link)]. Genomic-DNA was extracted using NucleoSpin Tissue kit (Macherey-Nagel). 500ng of genomic-DNA was digested in 30μl reaction using McrBC enzyme (NEB) for 3h at 37°C and hit-inactivated at 65°C for 20min. As a control, parallel reaction without McrBC was performed. The restriction products diluted to 90μl and 5μl served as a temple for Real-time PCR analysis with primers surrounding the CpG island promoter region. Product could be amplified only if there was no restriction, meaning all the amplicon was unmethylated. qPCR was performed using PerfeCTa SYBR Green SuperMix (Quantabio) with the following conditions: 2min 50°C, 10min 95°C, 45 cycles of 15sec 95°C, 1min 65°C. Primers used are CCCCGAGACTCTGGTACTGT and GAGTCCGCGCGAGATGG.