Comprehensive CRISPR Cell Surface Library

We designed a CRISPR library containing 4,993 sgRNAs targeting 1,157 previously reported cell surface genes (13 (link)), 49 core essential genes, and 49 nonessential genes. Each oligo (77 nt) contained 20 nt sgRNA, a 5′ universal flanking sequence (CTTGTGGAAAGGACGAAACACCG), and a 3′ flanking sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG). The oligo library was synthesized by CustomArray Inc. The sequences of the sgRNAs are provided in Dataset S1. The McspKO library was amplified and cloned into lentiCRISPRv2 plasmids using Gibson Assembly Reaction Master Mix (NEB, E2611S).

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Wang C., Feng X., Su D., Chen Z., Wang S., Tang M., Huang M., Nie L., Zhang H., Li S., Yin L., Johnson R.L., Hart T, & Chen J. (2022). Integrated screens uncover a cell surface tumor suppressor gene KIRREL involved in Hippo pathway. Proceedings of the National Academy of Sciences of the United States of America, 119(25), e2121779119.

Publication 2022

Gibson Assembly Reaction Master Mix

3 flanking sequence 5 flanking sequence Cell Crispr Essential genes Genes Library Oligo Plasmids

Corresponding Organization :

Other organizations : The University of Texas MD Anderson Cancer Center

Top 5 similar protocols

Variable analysis

independent variables

CRISPR library containing 4,993 sgRNAs targeting 1,157 previously reported cell surface genes, 49 core essential genes, and 49 nonessential genes

dependent variables

Not explicitly mentioned

control variables

The oligo library was synthesized by CustomArray Inc.
The sequences of the sgRNAs are provided in Dataset S1
The McspKO library was amplified and cloned into lentiCRISPRv2 plasmids using Gibson Assembly Reaction Master Mix (NEB, E2611S)

controls

Positive controls: Not explicitly mentioned
Negative controls: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!