Genotyping chr13 variants in Shelties

Primers were designed to amplify the region around the two variants of interest on chr13, chr13:43897196 (F- GCTCCCAAGAAGGGACAGAC; R- TTGGAATAAGATGACAGAGCAAG) and chr13:44170972 (F- AAACGATCCAGAGAGCAGATTAC; R- GAGCCCAGGCCAAGAGTG) using Primer3^{106 (link)}. PCR was carried out on a SimplyAmp thermocycler or GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA) using AmpliTaq Gold (Thermo Fisher, Waltham, MA) using standard reaction protocols with a touch-down thermocycler program starting at 65 ^oC annealing temperature and decreasing 0.5 ^oC each cycle for 20 cycles then an additional 20 cycles at 55 ^oC annealing temperature. Denaturing and extending temperatures were constant as per standard protocols.
Amplified DNA was sequenced using BigDye Terminator 3.1 (Applied Biosystems, Foster City, CA) and run on a 3730xl sequence analyzer (Applied Biosystems). The variants were genotyped using Sequencher 5.4.6 (GeneCodes Corporation, Ann Arbor, MI). Odds ratios were calculated using genotypes from 47 affected and 47 unaffected Shelties.

Free full text: Click here

Parker H.G., Harris A.C., Plassais J., Dhawan D., Kim E.M., Knapp D.W, & Ostrander E.A. (2024). Genome-wide analyses reveals an association between invasive urothelial carcinoma in the Shetland sheepdog and NIPAL1. NPJ Precision Oncology, 8, 112.

Publication 2024

SimplyAmp thermocycler GeneAmp PCR system 9700 AmpliTaq Gold BigDye Terminator 3.1 3730xl sequence analyzer Sequencher 5.4.6

Corresponding Organization :

Other organizations : National Institutes of Health, Institut de génétique et de développement de Rennes, Purdue University West Lafayette, National Cancer Institute

Top 5 similar protocols

Variable analysis

independent variables

Primer sequences used to amplify the regions around the two variants of interest on chr13:43897196 and chr13:44170972

dependent variables

Genotypes of the two variants of interest on chr13:43897196 and chr13:44170972
Odds ratios calculated from the genotypes of 47 affected and 47 unaffected Shelties

control variables

Thermocycler programs used for PCR amplification (touch-down program starting at 65°C annealing temperature and decreasing 0.5°C each cycle for 20 cycles, then an additional 20 cycles at 55°C annealing temperature)
Standard reaction protocols for PCR amplification using AmpliTaq Gold
Sequencing method using BigDye Terminator 3.1 and 3730xl sequence analyzer
Genotyping method using Sequencher 5.4.6 software

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!