Genomic Analysis of P. gingivalis FimA and FimB

Genomic DNA was isolated from P. gingivalis clinical strains using Genomic Mini kit (A&A Biotechnology). The fimA and fimB genes were amplified using Phusion™ High-Fidelity DNA Polymerase (Thermo Fischer) with primers: fimA uni-F (AAGTTTTTCTTGTTGGGACTTGC), fimA uni-R (AACCCCGCTCCCTGTATTCCGA) (28 (link)) and fimB F (ATCGTATCGGTGCTGATCTTACTCG), fimB R (TCTGCATATTGTTGCACTACGTCCC). The amplification cycles were as follows: 98°C 30s initial denaturation, then 35 cycles of denaturation, annealing and extension 98°C 10s, 68°C 30s and 72°C 30s, respectively, and final extension 72°C, 10 min, 4°C hold. PCR products were run in 1% agarose gels containing ethidium bromide and bands corresponding to the fimA or fimB gene size were extracted from the gel using GeneJET Gel Extraction Kit (Thermo Fischer). The fimA or fimB gene was then cloned into the pJET plasmid (Thermo Fischer). Recombined plasmids were propagated in E. coli DH5α strain and isolated using GeneJET Plasmid Miniprep Kit (Thermo Fischer). All kits were used according to manufacturer’s instructions. Isolated plasmids were sequenced by Genomed, Poland and results were analyzed using Needle (EMBOS-EBI) and Chromas Lite (Technelysium Pty Ltd) programs.