SARS-CoV-2 Whole Genome Sequencing

One of the virus isolates (from sample 10, 1st passage on LFBK-αvβ6 cells) was used for whole genome sequencing. Total RNA was extracted from the culture supernatant and used for sequence-independent single-primer amplification by a previously described method [13 (link)] with small modifications. First, cDNA was prepared with the qScript Flex cDNA Synthesis Kit (Quantabio, Beverly, MA, USA) and the K-8N primer (5′ GACCATCTAGCGACCTCCACNNNNNNNN 3′), from which dsDNA was synthesized with the same primer and the Klenow fragment of E. coli DNA Polymerase I (New England Biolabs, Ipswich, MA, USA). The dsDNA was purified with sparQ PureMag beads (Quantabio) and used as the template for PCR amplification with Phusion High-Fidelity polymerase and the K primer (5′ GACCATCTAGCGACCTCCAC 3′). The PCR product was cleaned up with a QIAEX II column (Qiagen), quantified with the QuantiFluor dsDNA system (Promega, Madison, WI, USA) and submitted to Eurofins, Constance, Germany for Ilumina paired-end sequencing.