Sequence-Specific Inhibition of NR3C1 Translation

A NR3C1 specific MAO was designed to bind the 5′UTR upstream of the translation initiation site in the rhesus macaque NR3C1 gene (XM_015141112.1: TGGAGTCCATCAGTGAATATCAACT), thereby inhibiting its translation. A MAO recognizing a splice site mutant of the human hemoglobin beta-chain (HBB) gene (AY605051: CCTCTTACCTCAGTTACAATTTATA) was used as a standard (STD) control. Both the NR3C1 and STD MAOs were synthesized with a 3′-carboxyfluorescein tag to aid in visualization during embryo microinjection. Oocytes were collected at 6 h or 36 h following hCG injection to rhesus macaque females undergoing a COS protocol. The MAOs were reconstituted in embryo grade water (Sigma- Aldrich, W1503) and microinjected using a CellTram vario, electronic microinjector and Transferman NK 2 Micromanipulators (Eppendorf, Hauppauge, New York, USA). The MAO concentration (0.3 mM) was chosen based on previous reports that this concentration of STD MAO did not impact blastocyst formation rates in both mice^{41 (link)} and rhesus macaques^{42 (link)}.