Fluorescent Reporter Plasmid Construction

The set of fluorescent reporters coding for eYFP and mCherry was obtained from Addgene (#31463, #31464, #31465, and #31466, deposited by Phil Sharp Lab) and are the same as those used in [17 (link)]. The second set of fluorescent reporters were cloned into pBI-CMV1 (Clontech). A nuclear localization sequence (NLS) (ATGGGCCCTAAAAAGAAGCGTAAAGTC) was appended to mCerulean-N1 (Addgene #27795, deposited by Steven Vogel Lab [57 (link)]) by PCR and then inserted into the main vector with ClaI and BamHI. mKOrange-NLS (Addgene #37346, deposited by Connie Cepko Lab [58 (link)]) was cloned into the vector using EcoRI blunt and BamHI. miR-20a regulatory elements were appended to the 3^′ UTR of mCerulean with the same strategy applied in [17 (link)]: the N=1 bulged miR-20 binding site (TACCTGCACTCGCGCACTTTA) was appended by PCR and for both constructs, CCGG spacers separate subsequent miR-20a regulatory elements.