Gene Expression Analysis by qRT-PCR

Expression of individual protein-coding gene transcripts was performed according to previous techniques [16 (link)]. Briefly, one microgram total RNA was used to generate cDNA by reverse transcription using Superscript II Reverse Transcriptase enzyme (Invitrogen). Quantitative real-time PCR was performed using a LightCycler 1.5 (Roche Diagnostics) in combination with QuantiTech SYBR Green PCR kit (Qiagen Ltd) as per manufacturer’s protocol and 1.25 μM of primer pair used Data were analyzed by LightCycler 1.5 software; data normalized to expression of β-Actin and represented at RQ values. Specific primers for each gene assayed were purchased from Sigma, and sequences used were as follows: β-Actin (Forward (F): gggtgtgatggtgggaatgg, Reverse: ggttggccttagggttcagg); Gfap (F: tatgaggaggaagttcgag, R: tgtctcttgcatgttactgg); IL1β (F: tgaagttgacggaccccaaa, R: agcttctccacagccacaat); P2x7 (F: ttggcaagatgtttctcgtg, R: actggcaggtgtgttccata);; Tnfα (F: ctcttcaagggacaaggctg, R: cggactccgcaaagtctaag); and Il6 (F: ctcagagtgtgggcgaacaa, R: actaactggaaggcttgccc).