HMGA1 Regulation of FoxO1 Promoter

ChIP was performed in HepG2 and EBV-transformed lymphoblasts, either untreated or pre-treated with HMGA1 siRNA or with HMGA1 cDNA, as described previously [11 (link), 30 (link), 43 (link)]. Formaldehyde-fixed DNA–protein complex was immunoprecipitated with anti-HMGA1 antibody [30 (link), 44 (link)], and the following primers for the FoxO1 gene promoter were used for PCR amplification of ChIP-ed DNA (30 cycles), using PCR ready-to-go beads (Amersham Pharmacia Biotech): human FoxO1 (NT_007819) for 5′-CCCAAGGCTTTGGTCCTATC-3′, rev 5′- GCCGGATTCACTGTATTCTTG -3′. PCR products were electrophoretically resolved on 1.5% agarose gel and visualized by ethidium bromide staining.