Quantitative RT-PCR was performed with gene-specific primers to monitor mRNA expression as described previously [77 (link)]. Briefly, RNA was isolated using Qiagen RNeasy Fibrous Tissue Mini Kit (Qiagen, Hilden, Germany) from heart tissue. Then, 100 μg of total RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad Laboratories Inc., Hercules, CA, USA). Specific primers (Agt: angiotensinogen, #qRnoCED0051666; Agtr1: angiotensin II receptor type 1, #qRnoCID0052626; Bax: BCL2-associated X apoptosis regulator, #qRnoCED0002625; Bcl2: B-Cell CLL/lymphoma 2 apopotosis regulator, #qRnoCED0006419; Cat: catalase, #qRnoCID0006360; Cma1: chymase, #qRnoCED0005462; Col1a1: collagen type 1 alpha 1 chain, #qRnoCED0007857; Ctgf: connective tissue growth factor, #qRnoCED0001593; Il1: interleukin-1, #qRnoCID0002056; Il6: interleukin-6, #qRnoCID0053166; Mmp2: matrix metalloproteinase 2, #qRnoCID0002887; Mmp9: matrix metalloproteinase 9, #qRnoCED0001183; Nos1: neuronal nitric oxide synthase, #qRnoCED0009301; Nos2: inducible nitric oxide synthase, #qRnoCID0017722; Nos3: endothelial nitric oxide synthase, #qRnoCID0005021; Nox4: NADPH-oxidase type 4, #qRnoCID0003969; Nppa: A-type natriuretic peptide, #qRnoCED0006216, Nppb: B-type natriuretic peptide, #qRnoCED0001541; Smad2, mothers against decapentaplegic homolog 2, #qRnoCID0005549; Smad3: mothers against decapentaplegic homolog 3, #qRnoCID0004164; Sod1: Cu/Zn superoxide dismutase (soluble) #qRnoCID0051055; Sod2: Mn superoxide dismutase (mitochondrial), #qRnoCID0008099; Sod3: Cu/Zn superoxide dismutase (extracellular), #qRnoCID0006360; Tgfb: transforming growth factor-β, #qRnoCID0009191, Tnf: tumor necrosis factor-α, #qRnoCED0009117) and SsoAdvanced™ Universal SYBR® Green Supermix (BioRad Laboratories Inc., Hercules, CA, USA) were used according to the manufacturer’s instructions. Peptidyl-prolyl isomerase A (Ppia, forward primer sequence: tgctggaccaaacacaaatg and reverse primer sequence: caccttcccaaagaccacat) was used as a housekeeping control gene for normalization.
Free full text: Click here