Actin Dynamics Regulation in Infection

HeLa cells and Caco2 monolayers were treated with 50 µM CK666 + 50 µM CK869 (Calbiochem), 25 µM SMIFH2 (Tocris), 4 µM Wiskostatin (Sigma), or equivalent volumes of DMSO for 15 min prior to infection. During infections, media containing bacteria and inhibitors were added to HeLa cells and Caco2 monolayers, and the latter cells were washed with PBS and given fresh inhibitor-containing media every hour during the course of infection. NIH3T3 cells expressing mCherry-βactin [97 (link)] were infected 3.5–4.0 h prior to treatment with inhibitors, and live imaging was completed 15–120 min after the addition of the inhibitors.
RNA and DNA transfections were performed using RNAiMAX or Lippofectamine-LTX reagents (Invitrogen). To clone GFP-mDia1, mDia1 plasmid DNA (variant BC143413, Dharmacon) was PCR amplified as a Kpn1-Not1 fragment using primers ATCATCGGTACCATGGAGCCGCCCGGCGGGAG, and ATCATCGCGGCCGCTTATTAGCTTGCACGGCCAACCAACTC and ligated into the vector pKC-EGFP-C1 [97 (link)]. The plasmid was maintained in E. coli XL-1 Blue. For transient expression, 100 ng of GFP-mDia1 plasmid was transfected in 6-well plates. Sigma MISSION siRNAs (see S2 Table) were used at 40 nM for RNAi experiments. Targets were selected based on HeLa cell expression data cataloged on the Human Protein Atlas (https://www.proteinatlas.org/cell).