Genetic Manipulation of Yersinia pseudotuberculosis

All Yersinia pseudotuberculosis (Yptb) strains used in this study were derived from YPIII [5] (link). Plasmid deficient Yptb has been previously described [5] (link). In frame deletions were generated using pCVD442 and 500–800 bps upstream and downstream of the DNA to be removed, as described [5] (link). Primer sequences used to generate the mrtAB knockout construct were the following: mrtAB FOR1: attaGCATGCTTGCTGGAAACGTTTAAAGCGTTTGG, mrtAB REV1: attaGAATTCTAATTGTGCAAACAATCTCACGCAGTTT, mrtAB FOR2: attaGAATTC AGGAGGTCGAAGC CGATGAATAAC, mrtAB REV2: attaGAGCTCTTGAAA TCAGCGCCATCCGCCAAT. For HA tagging of mrtA (YPK_3222), the HA sequence was inserted directly downstream of the ATG start codon of the operon. For the FLAG tagging of mrtB (YPK_3221), the FLAG sequence was inserted just upstream of the stop codon. The coding regions of the two genes are overlapping, which is why we avoided making any tags in the C terminus of MrtA or the N terminus of MrtB. Yptb were tagged with GFP by driving expression of GFP off the constitutive Tet promoter on pACYC184. The tetA::GFP promoter-gene fusion from pDW5 [52] (link) was PCR-amplified with SphI end sites and moved it into pACYC184 cut with SphI. Forward primer: 5′ gatcgcatgcgaattctcatgtttgacagcttat 3′ Reverse primer: 5′ gccgccgcaaggaatggtgcatgc. This plasmid is very stable in vivo. For the construction of the mrtAB complementation plasmid (pmrtAB), pACYC184 was digested with EcoRV and SalI, and the mrtAB operon was PCR-amplified with EcoRV and SalI end sites. The entire intergenic sequence in between YPK_3223 and YPK_3222 (101 bps) was included upstream of the mrtA start codon, and the mrtB terminator was included after the gene. The primers used for the complementation vector were: CompFor: attaTCTAGAATAATTCACTAAAAAATCTGTTTATCAATGGT, and CompRev: attaGTCGACAAGTGA GTGAGTGAGTGAGTGAGT. A YopE reporter strain was constructed with a FLAG-mCherry sequence immediately following the yopE stop codon. An isogenic, unmarked T3SS reporter strain was constructed that contains FLAG-mCherry sequence immediately after the yopE stop codon (see Fig. S1, panel A). A DNA fragment containing the FLAG-mCherry sequence, flanked by ∼1 kb of genomic sequence on each side of yopE stop codon was constructed by PCR and cloned into the SacI and BamHI sites of pSR47s. The resulting plasmid (pSR47s-yopE-FLAG-mCherry) was introduced into E. coli DH5α λpir and integrated onto the Y. pseudotuberculosis virulence plasmid via triparental mating using the helper strain HB101(RK600).