Quantifying Glucocorticoid Receptor Activity

For the reporter assays, A549 cells were stably transfected with a GRE-Luc plasmid, as previously described in Dendoncker et al. (2017) (link) (Dendoncker et al., 2017 (link)), using Lipofectamine and Lipofectamine Plus reagent according to the manufacturer’s instructions. Briefly, the luciferase reporter construct was driven by a synthetic GR-responsive promoter region containing two classic consensus GRE sequences (underlined) derived from the tyrosine aminotransferase (TAT) gene promotor AGATCTCTCTGCTGTACAGGATGTTCTAGCGGATCCTGCTGTACAGGATGTTCTAGCTACCTGCAG succeeded by a minimal IL6 promoter TATA box and followed by the luciferase gene of which the quantified luciferase expression is a direct measure of GR transcriptional activity. A549 cells stably transfected with GRE-Luc were transfected with a plasmid encoding flag-ZBTB32 at concentrations of 100 ng and 400 ng as indicated. Twenty-four hours after transfection, the medium was replaced by Optimem for cell starvation and 48h after transfection, the cells were stimulated with 1 μM Dex for 6h. Luciferase activity was measured using the Luciferase Assay System kit (Promega) on an Envision plate reader (PerkinElmer). The luciferase values are normalized to β-galactosidase activity. Graphs show the mean ± SEM of experiments performed in triplicate.