Site-Directed Mutagenesis Using Recombineering

Oligos used to replace the galK-targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro: 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH₂O to a final concentration of 200 ng/μl double-stranded oligo. An aliquot of 1 μl (200 ng) was used in the recombineering experiments. To introduce the G12D (G<>A) point mutation in the Nras BAC CITB 50J2, the following oligos were used for the second step (the introduced adenosine/thymidine base pair is underlined, the flanking sequences are homologous to the Nras BAC sequence): G12D S: 5′-TTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGATGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTTT-3′; G12D AS: 5′-AAAGTGGTTCTGGATTAGCTGGATCGTCAAGGCGCTTTTCCCAACACCATCTGCTCCAACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAAAA-3′. To introduce a loxP511 site in the RP23-341F12 BAC, the following oligos were used for the second step (loxP511 is underlined, the flanking sequences are homologous to the BAC sequence around position 95 kb): 95 kb loxP511 S: 5′-ACGTGTGAGCTCCGTGGACAACTCTCCCCGAAGATAACTTCGTATAGTATACATTATACGAAGTTATGTGACTCAGGGACCCTCTCAAGTGAGGCTCAGC-3′; 95 kb loxP511 AS: 5′-GCTGAGCCTCACTTGAGAGGGTCCCTGAGTCACATAACTTCGTATAATGTATACTATACGAAGTTATCTTCGGGGAGAGTTGTCCACGGAGCTCACACGT-3′.