The total RNA was extracted with the NucleoSpin® RNA Plus Kit (Macherey-Nagel, Hoerdt, France) according to manufacturer’s instructions. Reverse transcription and real-time PCR were performed as previously described [56 (link)]. The following primers (Eurogentec, Liège, Belgium) were used: β-actin (forward 5′-CTCTTCCAGCCTTCCTTCCT-3′, reverse 5′-AGCACTGTGTTGGCGTACAG-3′); DDIT3 (forward 5′-TGGAAGCCTGGTATGAGGAC-3′, reverse 5′-AAGCAGGGTCAAGAGTGGTG-3′).
XBP1 splicing analysis was performed by end-point PCR as described previously [57 ] using the following primers (Eurogentec; forward: 5′- GGAGTTAAGACAGCGCTTGG -3′, reverse: 5′- ACTGGGTCCAAGTTGTCCAG -3′).
XBP1 splicing analysis was performed by end-point PCR as described previously [57 ] using the following primers (Eurogentec; forward: 5′- GGAGTTAAGACAGCGCTTGG -3′, reverse: 5′- ACTGGGTCCAAGTTGTCCAG -3′).
Free full text: Click here
