Morpholino Knockdown of NvecGrl1 in Cnidarians

Translation-blocking antisense morpholino oligonucleotides (GeneTools, LLC) were designed to match the sequence of NvecGrl1. The sequences of the morpholinos used are:
NvecGrl1#1: ACGCTCCGACTGGAACTGCCATTCA
NvecGrl1#2: GAACTGCCATTCATTCCGCTTGTTC
control#1 (generic;^{36 (link)}): CCATTGTGAAGTTAAACGATAGATC
control#2 (NvecGrl1 mismatch): ACGCGCCTACTGGAATTGCTATTAA
The two morpholinos against NvecGrl1 are partially overlapping to avoid 5′UTR sequence that is present elsewhere in the genome. The sequence corresponding to the start codon in the NvecGrl1 morpholinos is underlined.
Six3/6: GTACTGCCGCACTGCAAGACTTGTC^{36 (link)}Fgfa1: ATAAGGTGGACGCATGACTTTGTAG
Fgfa2: CGTTAGCATGGTGATCGTCATGTTG^{33 (link)}

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Saina M., Busengdal H., Sinigaglia C., Petrone L., Oliveri P., Rentzsch F, & Benton R. (2015). A cnidarian homologue of an insect gustatory receptor functions in developmental body patterning. Nature communications, 6, 6243.

Publication 2015

Translation-blocking antisense morpholino oligonucleotides

5 utr Antisense Antisense oligonucleotides Generic Genome Morpholinos Start codon

Corresponding Organization :

Other organizations : University of Lausanne, University of Bergen, University College London

Top 5 similar protocols

Variable analysis

independent variables

Translation-blocking antisense morpholino oligonucleotides (GeneTools, LLC) designed to match the sequence of NvecGrl1
NvecGrl1#1 morpholino
NvecGrl1#2 morpholino
Control#1 morpholino (generic)
Control#2 morpholino (NvecGrl1 mismatch)
Six3/6 morpholino
Fgfa1 morpholino
Fgfa2 morpholino

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

positive controls

Control#1 morpholino (generic)
Six3/6 morpholino

negative controls

Control#2 morpholino (NvecGrl1 mismatch)

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!