Fungal DNA Extraction and Sequencing

DNA was extracted from 20 mg of the fungal isolate tissues using the DNeasy extraction kit (Qiagen, Inc., Venlo, The Netherlands) according to the manufacturer’s protocol. For DNA fragments containing internal transcribed spacers, the fragments fungi primer is (Forward (ITS1): TCCGTAGGTGAACCTGC, Reverse (ITS4): TCCTCCGCTTATTGATATGC). Including 5.8S, were amplified and sequenced with primer pair ITS5/ITS4. The PCR profile was: 2.5 μL 10× buffer, 1.4 μL 50 mM MgCl₂, 1.6 μL 25 mM dNTPs, 0.5 μL of each 10 mM primer (forward and reverse), 1 μL 1 mg/mL BSA, 1 μL DNA, 0.3 μL 5 U/μL Taq polymerase, and 16.2 μL ddH₂O. The PCR conditions were 1 min at 95 °C, 35 cycles of 1 min at 95 °C, 45 s at 58 °C and 1 min at 72 °C, and finally, 10 min at 72 °C. The amplicons were sequenced for both strands using Big Dye Terminator in an ABI 3730 genetic analyzer (Applied Biosystems, Waltham, MA, USA). The sequences were edited, and primers were trimmed using Seq Studio (Life Technologies, Carlsbad, CA, USA) and run following a medium module. BLAST was used to compare the sequences against those existing in the National Center of Biotechnology Information (NCBI) nucleotide databases. Sequencing was performed using Seq Studio (Life Technologies, Carlsbad, CA, USA) and run following a medium module [12 (link),13 (link)].