1Cells were seeded onto each nanofiber in triplicate and cultivated for 7 days in GM only, or for 7 days in GM followed by an additional 7 days in DM. Both GM and DM were replaced by fresh medium every 2 days. All cells from the triplicate were then harvested in 1 mL TriReagent (Sigma-Aldrich) and the total RNA was isolated according to the manufacturer’s instructions. Next, 1 μg of each total RNA sample was converted into cDNA, following the instructions in the RevertAid H minus first strand cDNA synthesis kit (Thermo Fischer Scientific). GAPDH was used as a reference gene (AGGTCGGTGTGAACGGATTTG and TGTAGACCATGTAGTTGAGGTCA). MyoD, Myf5, MyoG and Desmin were used as target genes with the following primers: for MyoD (GTGGCAGCGAGCACTACA and GACACAGCCGCACTCTTC), for Myf5 (GCAAAGACCCGTGACTTCAC and GCATGTGGAAAAGTGATA), for MyoG (TGAGAGAGAAGGGGGAGGAG and CGGTATCATCAGCACAGGAG) and for Desmin (GTGGAGCGTGACAACCTGAT and ATGTTCTTAGCCGCGATGGT). RT-qPCR was performed using a Corbett 3,000 device (Qiagen, Helden, Germany), using 0.4–0.8 μM of each primer, 1 μL (diluted 1:10) of each cDNA, and 5 μL of iTaq universal SYBR Green Supermix (Bio-Rad, Hercules, USA), in a final volume of 10 μL. Reactions were performed as follows: 50°C for 2 min, 95°C for 2 min, followed by 45 cycles of 94°C for 15 s, 60°C–62°C for 15 s, and 72°C for 20 s. The dissociation step was performed at the end of the amplification step. Relative gene expression was determined using REST2009 software (based on the model by Pfaffl et al., 2002 (link)).
Free full text: Click here
