Genomic DNA Library Preparation Protocol

Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoRI or SbfI (New England Biolabs [NEB]). Samples were heat-inactivated for 20 min at 65°C. 2.5 µL of 100 nM P1 Adapter, a modified Solexa© adapter (2006 Illumina, Inc., all rights reserved; for EcoRI digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′, for SbfI digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′, bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′) were added to the sample along with 1 µL of 100 mM rATP (Promega), 1 µL 10× EcoRI buffer, 0.5 µL (1000 U) T4 DNA Ligase (high concentration, NEB), 5 µL H₂O and incubated at room temperature (RT) for 20 min. Samples were again heat-inactivated for 20 min at 65°C, pooled, and randomly sheared (Bioruptor or Branson sonicator 450) to an average size of 500 bp. Samples were then run out on a 1% agarose (Sigma), 0.5× TBE gel and DNA 300 bp to 700 bp was isolated using a MinElute Gel Extraction Kit (Qiagen). The Quick Blunting Kit (NEB) was used to polish the ends of the DNA. Samples were then purified using a Quick Spin column (Qiagen) and 15 U of Klenow exo⁻ (NEB) was used to add adenine (Fermentas) overhangs on the 3′ end of the DNA at 37°C. After another purification, 1 µL of 10 µM P2 Adapter, a divergent modified Solexa© adapter (2006 Illumina, Inc., all rights reserved; top: 5′-Phos-CTCAGGCATCACTCGATTCCTCCGAGAACAA-3′, bottom: 5′-CAAGCAGAAGACGGCATACGACGGAGGAATCGAGTGATGCCTGAGT-3′), was ligated to the DNA fragments at RT. Samples were again purified and eluted in 50 µL. 5 µL of this product was used in a PCR amplification with 50 µL Phusion Master Mix (NEB), 5 µL of 10 µM modified Solexa© Amplification primer mix (2006 Illumina, Inc., all rights reserved; P1-forward primer: 5′-AATGATACGGCGACCACCGA-3′; P2-reverse primer: 5′-CAAGCAGAAGACGGCATACGA-3′), and 40 µL H₂O. Phusion PCR settings followed product guidelines (NEB) for a total of 18 cycles. Samples were gel purified, excising DNA 300–700 bp, and diluted to 10 nM. Illumina Solexa protocols were followed for sequencing. Sequences are available at the Short Read Archive (http://www.ncbi.nlm.nih.gov/Traces/sra/), at accession SRA001825.1.