Real-time PCR Detection of C. gallinacea

The presence of C. gallinacea DNA was examined using a real-time PCR developed by Laroucau et al. [33 (link)] and further described by Heijne et al. [16 (link)]. This PCR detects the enoA gene with a sensitivity of 5 copies/reaction, using the primer sequences FW “CAATGGCCTACAATTCCAAGAGT” and REV “CATGCGTACAGCTTCCGTAAAC” and probe sequence “FAM-ATTCGCCCTACGGGAGCCCCTT-TAMRA”. Each reaction consisted of 5 µL of the DNA template, 10 µL of TaqMan™Fast Universal PCR Master Mix (2×) (Applied Biosystems, Dublin, Ireland), 1 µM of the forward and reverse primers, 0.2 µM of the probe, and 1 unit of AmpErase™ Uracil N-glycosylase (Applied Biosystems). DNA amplification was performed with the following cycling conditions: 37 °C for 5 min, 95 °C for 20 s, followed by 50 cycles of 95 °C for 3 s and 60 °C for 30 s. According to validation with an in-house control plasmid, samples with a Ct value lower than 38 were considered positive.