SNP Genotyping in Acute Myeloid Leukemia

Bone marrow (2 ml) from each AML patient was drawn into Vacutainer tubes containing EDTA and stored at −80°C, and 2 ml of peripheral blood from the control subjects was preserved using the same procedure. Subsequently, genomic DNA was isolated using the DNA isolation kit (Aidlab Biotechnologies, Beijing, China) and preserved at −80°C. SNP genotyping of AML was carried out using the SNaPshot Multiplex kit (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the primers were shown as follows: Forward, ATAGCTGGGGCTATGCGATTTG and reverse, GTTGGGGAGGTCTTGAAGGAGA. The genotyping information of the controls was extracted from the FAMHES database and the Omni 1 platform (Illumina, Inc., San Diego, CA, USA) was used for genotyping. The methods used were as previously described (28 (link)).