Phage Display Library Construction

The starting material for library construction was the pHEN C1 phagemid previously described [16] (link). Plasmid DNA was submitted to random mutagenesis by epPCR using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) according to the high mutation rate protocol using the C1 specific upstream primer 5′TTATTACTCGCGGCCCAGCCGG3′ that hybridized just upstream of the NcoI restriction site of the pHEN vector and downstream primer 5′ GTGATGGTGATGATGATGTGC 3′. The mutated gene fragments were gel purified and digested with NcoI and NotI (New England Biolabs) followed by ligation into the corresponding sites of the pHEN phagemid containing an irrelevant scFv in order to avoid the presence of the native scFvC1 in the subsequent steps of affinity maturation. The library was subsequently transformed into electro competent XL1 blue Escherichia coli (E.coli) (Stratagene) and random clones sequenced with the primers LMB3 5′ACAGGAAACAGCTATGACC3′ and pHEN-SEQ 5′CTATGCGGCCCCATTCAG3′.