Transposon Insertion Sequencing Library Prep

Library preparation and sequencing were performed as previously described (68 (link)) by the Microarray and Genomics Core at the University of Colorado Anschutz Medical Campus. Briefly, genomic DNA was sheared to approximately 340-bp fragments and processed through the Ovation ultralow V2 DNA-Seq library preparation kit (Tecan), and 9 ng of each library was used as a template for enrichment by PCR (16 cycles) for the transposon insertions using Krmit-specific (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCATCCAACC) and Illumina P7 primers. The enriched PCR products were diluted 1:100, and 20 μL was used as a template for an indexing PCR (9 cycles) using the TruSeq P5 indexing and P7 primers. Sequencing was performed to obtain roughly 20 million reads per sample using an Illumina NovaSeq 6000 system in a 150-base paired-end format.