16S rRNA Gene Sequencing of Mouse and Human Samples

DNA was amplified using Kapa-HiFi Hotstart (KK2502, Kapa Biosystems) using primers to 16S-V4 regions (V4-515F - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA, V4-806R - GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT) on a BioRad CFX 384 real-time PCR instrument with four serial 10-fold dilutions of extracted DNA template. Individual sample dilutions in the exponential phase were selected using an OpenTrons OT2 for subsequent indexing PCR using a dual GoLay error-correcting index primers (37 (link)). DNA concentration was measured using a PicoGreen assay (P7589, Life Technologies, South San Francisco, CA, USA), and samples were pooled at equimolar concentrations. Agencourt AMPure XP magnetic beads were used to purify the pooled PCR product, and the samples were subsequently sequencing on an Illumina MiSeq using 15% PhiX spiked in for sequencing. Mouse samples were amplified using V4 primers as previously described (38 (link)). All sequencing was paired, with human 16S as 270 bp and mouse 16S as 150 bp fragments. Amplicon reactions were pooled at equimolar concentrations and purified using the Agencourt AMPure XP magnetic beads. The pooled library was loaded onto the Illumina NextSeq 550 platform using 40% PhiX spiked in for sequencing.