Cardiac Gene Expression Analysis

Trizol (Invitrogen Co., Carlsbad, CA, United States) was used to extract RNAs from homogenized myocardia (n = 4 hearts/group). After the normalization of RNA concentrations, cDNAs were synthesized using Revertra ace^® qPCR rt kit (Toyobo, Osaka, Japan). By using SYBR Green Master Mix (Vazyme Biotech, Nanjing, China), the following gene primers (Sangon Biotech, Shanghai, China) were used to evaluate mRNA expressions; (1) Tumor necrosis factor-alpha (TNF-α), Forward GAAAGCATGATCCGAGATGTG; Reverse: CACGAGCAGGAATGAGAAGAG, (2) transforming growth factor-beta (TGF-β1), Forward: ATGGTGGACCGCA ACAACGC; Reverse: CTGGCACTGCTTCCCGAATGTC, (3) inducible nitric oxide synthase (iNOS), Forward: TCTTGGAGCGAGTTGTGGATTGT; Reverse: TAGGTGAGG GCTTGCCTGAGTG, (4) arginase 1 (Arg-1), Forward: CGTTG ACCTTGTCTTGTTTTGG; Reverse: CTGGTTCTGTTCGGT TTGCTG, (5) glyceraldehyde 3-phosphate dehydrogenase (GAPDH), Forward: TCCTGCACCACCAACTGCTTAG; Reverse: AGTGGCAGTGATGGCATGGACT.
The 2^–ΔΔCt analysis method was used to evaluate the relative mRNA levels as described (Gold et al., 2012 (link)) and have been graphically presented as fold changes compared with the Sham group.

Free full text: Click here

Hou H., Adzika G.K., Wu Q., Ma T., Ma Y., Geng J., Shi M., Fu L., Rizvi R., Gong Z, & Sun H. (2021). Estrogen Attenuates Chronic Stress-Induced Cardiomyopathy by Adaptively Regulating Macrophage Polarizations via β2-Adrenergic Receptor Modulation. Frontiers in Cell and Developmental Biology, 9, 737003.

Publication 2021

Trizol Revertra ace® qPCR rt kit SYBR Green Master Mix gene primers

Arginase 1 Cdnas Gene Glyceraldehyde 3 phosphate dehydrogenase Gold Hearts Inducible nitric oxide synthase Mrna Myocardia Primers Sybr green Tgf β1 Tnf α Transforming growth factor beta Trizol

Corresponding Organization : Xuzhou Medical College

Other organizations : Shangqiu Normal University, Silliman University

Top 5 similar protocols

Variable analysis

independent variables

Groups (Sham group vs. experimental group)

dependent variables

MRNA expression levels of:
1. Tumor necrosis factor-alpha (TNF-α)
2. Transforming growth factor-beta (TGF-β1)
3. Inducible nitric oxide synthase (iNOS)
4. Arginase 1 (Arg-1)

control variables

RNA extraction method (Trizol)
CDNA synthesis method (Revertra ace® qPCR rt kit)
QPCR method (SYBR Green Master Mix)
Housekeeping gene (GAPDH)
Sample size (n = 4 hearts/group)

controls

Sham group (negative control)

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!