Relative ADGRG1 levels were quantified using the ABsolute qPCR SybrGreen Mix (Thermo Fisher) and primers (forward/reverse) gcggggaggctgagaagagact/caggccagggcagagacgacacag on a Rotor-Gene 3000 thermal cycler (Qiagen, Hilden, Germany) with the ΔCt method [26 (link)]. ADGRG1 was normalized to RPL27 as an endogenous control.
For RNA-sequencing, 100 ng total RNA was rRNA-depleted using the NEBNext® rRNA Depletion Kit v2 (NEB) and then fragmented. The NEBNext Ultra II Directional RNA Library Prep Kit (NEB) was used for random primed library preparation from this RNA. The barcoded libraries were purified, quantified using the Library Quantification Kit- Illumina/Universal (KAPA Biosystems), and their size distribution was analyzed (FragmentAnalyzer, Agilent). Sequencing of 2 × 150 bp was performed with an Illumina NextSeq 550 sequencer (Illumina, San Diego, CA, USA). After demultiplexing with bcl2fastq software (Illumina, v2.20) and polishing using fastp [27 (link)], reads were mapped against the human reference genome (hg38) using HISAT2 [28 (link),29 (link)]. Stringtie and the R package Ballgown [30 (link)] were employed to calculate differential expression.
For RNA-sequencing, 100 ng total RNA was rRNA-depleted using the NEBNext® rRNA Depletion Kit v2 (NEB) and then fragmented. The NEBNext Ultra II Directional RNA Library Prep Kit (NEB) was used for random primed library preparation from this RNA. The barcoded libraries were purified, quantified using the Library Quantification Kit- Illumina/Universal (KAPA Biosystems), and their size distribution was analyzed (FragmentAnalyzer, Agilent). Sequencing of 2 × 150 bp was performed with an Illumina NextSeq 550 sequencer (Illumina, San Diego, CA, USA). After demultiplexing with bcl2fastq software (Illumina, v2.20) and polishing using fastp [27 (link)], reads were mapped against the human reference genome (hg38) using HISAT2 [28 (link),29 (link)]. Stringtie and the R package Ballgown [30 (link)] were employed to calculate differential expression.
Free full text: Click here
