Bacterial 16S rRNA Gene Amplification

Genomic DNA was isolated from each pure culture using QIAamp DNA mini kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions. The PCR amplifications were performed using universal primers 27F (5′ AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′ TACGGCTACCTTGTTACGACTT 3′) [40 (link)] targeting 16S rRNA gene sequences. Polymerase Chain Reaction (PCR) was performed with a reaction mixture containing 1x PCR buffer (Invitrogen), 0.5 μM of each primer, 2.5 mM MgCl₂, 200 ng of purified DNA, 0.2 mM dNTPs, and 0.3 units of Taq polymerase (Invitrogen). The total volume was adjusted to 25 μL. The PCA media and ddH₂O were used as negative controls. Samples were amplified according to the following cycle: initial denaturation at 94°C for 10 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min. The final extension was at 72°C for 8 min.
The amplified product was visualized on a 1% agarose gel containing ethidium bromide using a UV transilluminator. The PCR amplicons were then purified using the QIAquick PCR Purification Kit (Qiagen). The purified products were sent to Macrogen, South Korea (Macrogen Inc., 1001, 254 Beotkkot-ro, Geumcheon-gu, Seoul, Republic of Korea) for 16S ribosomal RNA partial gene sequencing by the Sanger method.