Cloning and Characterizing HIV Quasispecies

The inference and cloning of T/F Envs and IMCs from SGA-derived viral sequences has been described (Figure S1) [10] (link), [12] (link), [13] (link), [25] (link), [37] (link). To ensure efficient expression of cloned subtype C Envs for pseudotyping, the sense primer used for amplification of the corresponding rev1-vpu-env cassette lacked the rev initiation codon (underlined) (5′-CACCGGCTTAGGCATCTCCTATAGCAGGAAGAA-3′) [39] (link).
Since chronic HIV-1 infections represent complex quasispecies of genetic variants, it is impossible to predict, based on sequence analysis alone, which members of this quasispecies are functional and which are defective or partially defective. To generate biologically relevant chronic controls, we thus targeted viral variants for both Env and IMC construction that exhibited evidence of a recent clonal expansion. Viral RNA was extracted from the plasma of chronically infected individuals and subjected to SGA and direct amplicon sequencing as described [12] (link), [13] (link), with the following modifications: 5′ half genome amplification: 1^st round sense primer 2010ForRC 5′- GTCTCTCTAGGTRGACCAGAT -3′, 1^st round antisense primer 2010Rev1C 5′- AAGCAGTTTTAGGYTGRCTTCCTGGATG -3′, 2^nd round sense primer 2010R1C 5′- TAGGTRGACCAGATYWGAGCC -3′ and 2^nd round antisense primer 2010Rev2C 5′- CTTCTTCCTGCCATAGGAAAT -3′; 3′ half genome: 1^st round sense primer 07For7 5′- CAAATTAYAAAAATTCAAAATTTTCGGGTTTATTACAG -3′, 1^st round antisense primer 2.R3.B6R 5′- TGAAGCACTCAAGGCAAGCTTTATTGAGGC-3′, 2^nd round sense primer VIF1 5′- GGGTTTATTACAGGGACAGCAGAG -3′ and 2^nd round antisense primer Low2C 5′- TGAGGCTTAAGCAGTGGGTTCC -3′. Thermal cycling conditions were identical to [13] (link) except that 60°C was used for primer annealing. Sequences were then aligned using ClustalW [81] (link) and subjected to phylogenetic analysis using PhyML [82] (link). Phylogenetic trees were inspected for clusters of closely related viruses, or “rakes”, which are indicative of a recent clonal expansion. (Figures 1, S2 and S3). In five subjects (Table 1), at least one env amplicon was identical in sequence to the inferred “rake” consensus and thus selected for cloning using the pcDNA3.1 Directional Topo Expression kit (Invitrogen). In two subjects, observable “rakes” were limited to only two closely related sequences, which encoded Env proteins that differed by a single amino acid. In these cases, the amplicon that matched the within patient consensus at this ambiguous site was cloned. In the remaining six subjects, the consensus sequences of the clonal expansion “rakes” were chemically synthesized and cloned (designated .synR1 in Table 1). IMCs from chronically infected subjects (CH256, CH432, CH457, and CH534) were generated using the same approach. 3′ and 5′ half-genome SGA was performed using viral RNA from subjects with evidence of clonal expansion as determined by env sequencing. 3′ and 5′ half genome sequences were used to construct neighbor joining trees (Figure S3), and clusters of closely related sequences were selected for further analysis. A consensus sequence of the members of such “rakes” was generated using Consensus Maker (hiv.lanl.gov). 3′ and 5′ half genome sequences were confirmed to be identical in their 1,040 bp overlapping regions, chemically synthesized in fragments bordered by unique restriction enzymes, and ligated together to construct infectious proviral clones.