qRT-PCR Analysis of Hypothalamic GnRH1

For RT-qPCR, the hypothalamus was collected from males that were euthanized by CO₂ overdose. Hypothalami were snap frozen on dry ice and stored at −80°C until RNA extraction. Total RNA was extracted using TRIzol (Invitrogen). Genomic DNA was eliminated using the DNA-free kit (Applied Biosystems). cDNA was obtained by reverse transcription of total RNA using an iScript cDNA synthesis kit (Bio-Rad Laboratories). cDNA products were detected using an iQ SYBR Green Supermix (Bio-Rad Laboratories) on a qRT-PCR CFX real-time detection system (Bio-Rad Laboratories). qRT-PCR primers were previously published (Hoffmann et al., 2014 (link); Larder et al., 2011 (link)), Gnrh1F: ACACTTGGTTGAGTCTTTCCA, Gnrh1R: TGGCTTCCTCTTCAATCAGAC; GapdhF TGCACCACCAACTGCTTAG; GapdhR: GGATGCAGGGATGATGTTC. Data were expressed as fold change using the 2-δδCT method by normalizing Gnrh1 to Gapdh (Livak & Schmittgen, 2001 (link)). Data represent mean fold change ± SEM from a minimum of three independent mice for each data point.