Allele-Specific PCR for Genotyping Mosquito Mutations

Genotyping of the mutants V1016G and F1534C was performed according to previous report in literature [14 (link), 31 (link)] for allele-specific PCR assays. For detection of V1016G, the PCR consisted of 1 μl of 10 pmol forward primer 5′ACCGACAAATTGTTTCCC3′, 0.5 μl of 10 pmol of each reverse primer 5′GCGGGCAGGGCGGCGGGGGCGGGGCCAGCAAGGCTAAGAAAAGGTTAACTC3′ and 5′GCGGGCAGCAAGGCTAAGAAAAGGTTAATTA3′, 12.5 μl of Dream Taq Green PCR Master Mix® (Thermo Fisher Scientific) in a 25 μl total reaction volume. PCR reactions were performed as follows: 94°C at 2 min, 35 cycles of 30 s at 94°C, 30 s at 55°C, 30 s at 72°C, and a final elongation step for 2 min at 72°C. PCR amplification products were then loaded onto a 3% agarose gel. The F1534C detection PCR consisted of 1 μl of 10 pmol forward primer 5′GCGGGCTCTACTTTGTGTTCTTCATCATATT3′, 0.5 μl of 10 pmol of the forward primer 5′GCGGGCAGGGCGGCGGGGGCGGGGCCTCTACTTTGTGTTCTTCATCATGTG3′ and 1 μl of reverse primer 5′TCTGCTCGTTGAAGTTGTCGAT3′, 12.5 μl of Dream Taq Green PCR Master Mix® (Thermo Fisher Scientific) in a 25 μl total reaction volume. Reactions were performed as follows: 94°C at 2 min, 35 cycles of 30 s at 94°C, 30 s at 60°C, 30 s at 72°C, and a final elongation step for 2 min at 72°C. PCR amplification products were then again loaded onto a 3% agarose gel.