Genetic Engineering of Protein Expression Plasmids

A pFastBac1 expression vector (Invitrogen) was used to construct plasmids expressing TOP2A-N, TOP2A-C, or full-length PTEN in SF9 insect cells. The N-terminal truncated TOP2A includes amino acids 1–705 and C-terminal truncated TOP2A includes amino acids 668–1531. pET28a (+) plasmid was used for the PTEN N-terminal domain, PTEN C-terminal domain, or control proteins with His-tag. N-terminal PTEN included amino acids 1-189, and C-terminal PTEN included amino acids 190–403. Exogenous OTUD3 was overexpressed in an S-HA tagged vector. An S-protein-HA tag was fused to the N-terminal of exogenously expressed OTUD360 (link). Expression vectors containing FLAG-HA epitope tags were a gift from Dr. W. Gu at Columbia University. DsiRNAs were ordered from IDT with sequences GCCCGCGCUUUUAACCU and AGGCCAUGUCCCGAAGC. The CRISPR plasmids used for the construction HCT116 TOP2A^+/− cells targeting exon 4 of TOP2A with the sequence GTGGGTTTACGATGAAGATGT were gifts from Dr. Xi at Peking University and the procedure was carried out as previously described61 (link). The CRISPR targeting sequence used for the construction of PTEN^+/− mice was CCAGACATGACAGCCATCATCAAAG in PTEN exon 1, and the procedure used for CRISPR/Cas-mediated genomic engineering to generate mice carrying mutations was carried out with reference to the work of Wang et al.62 (link).