Quantifying E. coli in Ileum Digesta

The major sites of microbial fermentation, propagation, and colonization of enteropathogens in the monogastric are the ileum, which is why in this study the population of E. coli was analyzed only in the ileum section. The entire ileum digesta was taken and mixed and 100 mg of the digesta was used for the DNA extraction using QIAamp DNA Stool Mini Kit (Germany). The quantitative real-time PCR was applied using the SYBR Green PCR Master Mix (Biofact, Korea). The fold changes for the E. coli in the ileum digesta was determined using the 2^−∆∆Ct method as described earlier [35 , 36 (link)]. The primer used in this study are study are E. coli (O157:H7) ( F: ttaccagcgataccaagagc; R: caacatgaccgatgacaagg) [37 ] and Total bacteria (F: cggcaacgagcgcaaccc; R: ccattgtagcacg tgtgtagcc) [38 (link)].