Southern Blot Analysis for Targeted Integration

To verify homologous recombination at the AAVS1 locus a 705-bp probe specific for both the endogenous PPP1R12C sequence and the 5’-homology arm of our constructs was synthesized by PCR amplification using primers AAV5Pb-F: 5’–GGCCTGGGTCACCTCTACG and AAV5Pb-R: 5’–GAACCAGAGCCACATTAACCG and DIG-dUTP labeling kit (Roche). 10μg of genomic DNA were digested with SphI overnight, after which Southern blotting and chemi-luminescence detection with CSPD were carried out following the instruction manuals of DIG High Prime DNA Labeling and Detection Starter Kit II (Roche). Based on the digestion pattern wild-type and targeted integration yield expected bands of 6.5kb and 3.8kb, respectively, due to the presence of an SphI site within our constructs. Verification of homologous recombination at the CLYBL locus was conducted similarly using a 528-bp probe specific for both the endogenous CLYBL sequence and the 5’-homology arm of our constructs synthesized using primers C13–5Pb-F: 5’–GGCATACCATCAAGTCCAAAG and C13–5pb-R: 5’–TTGGGGAAGAACAAAGAAGG. 10μg of genomic DNA were digested with AvrII overnight, which, after probe hybridization and imaging, yields expected bands of 5.4kb or 3.2kb for wild-type or targeted integrations for all CLYBL targeting donors, respectively. When BamHI was used with the CLYBL probe, a wild type band of 4.4kb and TI band of 11.2kb is expected for pC13N-CAGcopGFP.