Fracture Callus RNA and Protein Analysis

Total RNA from D14 fractured calluses and POBs were isolated with Trizol Reagent (Life Technologies) and cDNA was prepared from 1 μg total RNA using the PrimeScriptTM RT reagent kit (Takara Bio). Quantitative real-time RT-PCR was performed with SYBR Green PCR master Mix (Invitrogen). The relative gene expression was calculated as described previously [9 (link)]. Primer sequences are listed in Table 2. Western blots from D21 fractured callus samples were carried out as previously described [9 (link), 18 (link)] using rabbit anti-IFT80 antibody (1:400, PAB15842, Abnova) and rabbit anti-Foxo1 antibody (1:500, 2880S, Cell Signaling). Beta-actin was used as a loading control. Protein band intensities were measured using ImageJ software and normalized to beta-actin.Table 2

List of RT-qPCR primer sequences.

Name	Forward primer sequence	Reverse primer sequence
IFT80	AAGGAACCAAAGCATCAAGAATTAG	AGATGTCATCAGGCAGCTTGAC
OSX	AGCGACCACTTGAGCAAACAT	GCGGCTGATTGGCTTCTTCT
ALP	ATCTTTGGTCTGGCTCCCATG	TTTCCCGTTCACCGTCCAC
Col-1	GCAACAGTCGCTTCACCTACA	CAATGTCCAAGGGAGCCACAT
Foxo1	GCTGCATCCATGGACAACAACA	CGAGGGCGAAATGTACTCCAGTT
GAPDH	ACTTTGTCAAGCTCATTTCC	TGCAGCGAACTTTATTGATG

Free full text: Click here

Chinipardaz Z., Yuan G., Liu M., Graves D.T, & Yang S. (2023). Diabetes impairs fracture healing through Foxo1 mediated disruption of ciliogenesis. Cell Death Discovery, 9, 299.

Publication 2023

Trizol Reagent PrimeScriptTM RT reagent kit SYBR Green PCR master Mix PAB15842

Anti antibody Beta actin Callus Cdna Gene expression Primer Quantitative real time pcr Rabbit Sybr green Trizol Western blots

Corresponding Organization : Center for Innovation

Top 5 similar protocols

Variable analysis

independent variables

Day 14 fractured calluses
Peripheral osteoblasts (POBs)

dependent variables

Gene expression (IFT80, OSX, ALP, Col-1, Foxo1)
Protein expression (IFT80, Foxo1)

control variables

Total RNA isolation using Trizol Reagent
CDNA preparation from 1 μg total RNA using PrimeScript RT reagent kit
Quantitative real-time RT-PCR using SYBR Green PCR master mix
Relative gene expression calculation as described in reference [9]
Western blot analysis of Day 21 fractured callus samples as previously described in references [9] and [18]
Beta-actin as loading control for Western blots
Protein band intensity measurement and normalization to beta-actin using ImageJ software

controls

Positive control: Not explicitly mentioned
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!