Genomic DNA Extraction and 16S rRNA Amplification

Culture cells were harvested from a 48 hour (OD₆₀₀ = 0.8) actively growing in a nutrient broth of NBRIB. Approximately 1.5 μL (10⁸ CFU Ml⁻¹) of bacterial culture were pipetted into 2 mL microtubes followed by spinning at 20,000 × g for 5 minutes in a centrifuge. The total DNA of selected PSB isolates was extracted using QIAmp DNA kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. The template DNA (8 μl) was qualitatively checked by Gel-electrophoresis in a 1.5% agarose gel (prestained with ethidium bromide 0.5 μg mL⁻¹), then visualized on a UV trans-illuminator and photographed. The DNA was stored at −20°C for downstream processes.
16S ribosomal RNA gene was amplified using the following universal primers: 27f (5′AGAGTTTGATCCTGGCTCAG 3′) and 1492r (5′ TACGGCTACCTTGTTACGACTT 3′).Gene amplification was carried out in 25 μL reaction volumes containing 2.5 μL 10X DreamTaq buffer (100 mM Tris-HCl, pH 8.0, 500 mM KCl, and 1.5 μL 25 mM MgCl), 2.0 μL, 2.5 mM, dNTPs, 0.5 μL of 27f primer (200 ng/μL), 0.5 μL of 1492r primer (200 ng/μL), 0.25 μL DreamTaq DNA polymerase (5U/l), and 10 μl of extracted template of phosphorus solubilizing bacterial DNA. The reaction volume was accustomed to up to 25 μL with sterile distilled water. The PCR thermal cycling process consisted of an initial DNA denaturation stage at 94°C for 3 minutes, followed by 35 cycles of DNA denaturation (1 min at 94°C), an annealing stage for 1 minute at 57°C, and an extension period for 2 minutes at 72°C, followed by a final elongation stay at 72°C for 8 minutes [35 (link)].