Antibody and Hashtag Library Generation for 10x 3P v3
The 10x 3P v3 protocol was followed according to manufacturer’s instructions for cDNA amplification, with the following modifications:
During cDNA amplification, 0.2 μM of ADT additive primer (5′CCTTGGCACCCGAGAATTCC) and 0.2 μM of HTO additive primer (5′GTGACTGGAGTTCAGACGTGTGCTC) were added to the reaction.
During cDNA cleanup, the supernatant from the 0.6x SPRI cleanup was saved and purified with two rounds of 2x SPRI. The eluate was split and used as template for production of ADT and Hashtag libraries:
Hashtag libraries were generated by PCR using Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer (5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC), and 10 μM Illumina TruSeq DNA D7xx primer (5′CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCAGACGTGTGC). Following amplification, Hashtag libraries were and cleaned up with 1.6x SPRI.
Antibody tag libraries were generated by PCR using Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM TruSeq Small RNA RPIx primer (5′CAAGCAGAAGACGGCATACGAGxxxxxxxxGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA) Following amplification, Antibody tag libraries were and cleaned up with 1.6x SPRI.
Addition of 0.2 μM of ADT additive primer (5′CCTTGGCACCCGAGAATTCC) during cDNA amplification
Addition of 0.2 μM of HTO additive primer (5′GTGACTGGAGTTCAGACGTGTGCTC) during cDNA amplification
Use of 10 μM 10x Genomics SI-PCR primer (5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC) for Hashtag library generation
Use of 10 μM Illumina TruSeq DNA D7xx primer (5′CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCAGACGTGTGC) for Hashtag library generation
Use of 10 μM TruSeq Small RNA RPIx primer (5′CAAGCAGAAGACGGCATACGAGxxxxxxxxGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA) for Antibody tag library generation
dependent variables
Amplification of cDNA
Generation of Hashtag libraries
Generation of Antibody tag libraries
control variables
Following the 10x 3P v3 protocol according to manufacturer's instructions for cDNA amplification, with the specified modifications
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
